BCL-2 (PTR2303) mouse mAb

    • Catalog No.:YM3041
    • Applications:WB;IF;ELISA
    • Reactivity:Human;Mouse;Rat;
      • Target:
      • Bcl-2
      • Fields:
      • >>EGFR tyrosine kinase inhibitor resistance;>>Endocrine resistance;>>Platinum drug resistance;>>NF-kappa B signaling pathway;>>HIF-1 signaling pathway;>>Sphingolipid signaling pathway;>>p53 signaling pathway;>>Autophagy - animal;>>Protein processing in endoplasmic reticulum;>>PI3K-Akt signaling pathway;>>Apoptosis;>>Apoptosis - multiple species;>>Necroptosis;>>Adrenergic signaling in cardiomyocytes;>>Hedgehog signaling pathway;>>Focal adhesion;>>NOD-like receptor signaling pathway;>>JAK-STAT signaling pathway;>>Neurotrophin signaling pathway;>>Cholinergic synapse;>>Estrogen signaling pathway;>>Parathyroid hormone synthesis, secretion and action;>>AGE-RAGE signaling pathway in diabetic complications;>>Amyotrophic lateral sclerosis;>>Pathways of neurodegeneration - multiple diseases;>>Shigellosis;>>Salmonella infection;>>Toxoplasmosis;>>Tuberculosis;>>Hepatitis B;>>Measles;>>Herpes simplex virus 1 infection;>>Epstein-Barr virus infection;>>Human immunodeficiency virus 1 infection;>>Pathw
      • Gene Name:
      • BCL2
      • Protein Name:
      • Apoptosis regulator Bcl-2
      • Human Gene Id:
      • 596
      • Human Swiss Prot No:
      • P10415
      • Mouse Swiss Prot No:
      • P10417
      • Immunogen:
      • Synthetic Peptide of human Bcl-2 AA range: 1-100
      • Specificity:
      • This antibody detects endogenous levels of BCL-2 protein.
      • Formulation:
      • PBS, 50% glycerol, 0.05% Proclin 300, 0.05%BSA
      • Source:
      • Mouse, Monoclonal/IgG2b, Kappa
      • Dilution:
      • WB 1:500-2000. IF 1:100-500. ELISA 1:1000-5000
      • Purification:
      • Protein G
      • Concentration:
      • 0.73mg/mL
      • Storage Stability:
      • -15°C to -25°C/1 year(Do not lower than -25°C)
      • Other Name:
      • BCL2;Apoptosis regulator Bcl-2
      • Molecular Weight(Da):
      • 26kD
      • Observed Band(KD):
      • 26kD
      • Background:
      • BCL2, apoptosis regulator(BCL2) Homo sapiens This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016],
      • Function:
      • disease:A chromosomal aberration involving BCL2 may be a cause of follicular lymphoma (FL) [MIM:151430]; also known as type II chronic lymphatic leukemia. Translocation t(14;18)(q32;q21) with immunoglobulin gene regions. BCL2 mutations found in non-Hodgkin lymphomas carrying the chromosomal translocation could be attributed to the Ig somatic hypermutation mechanism resulting in nucleotide transitions.,domain:The BH4 motif is required for anti-apoptotic activity and for interaction with RAF-1.,function:Suppresses apoptosis in a variety of cell systems including factor-dependent lymphohematopoietic and neural cells. Regulates cell death by controlling the mitochondrial membrane permeability. Appears to function in a feedback loop system with caspases. Inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activati
      • Subcellular Location:
      • Membranous
      • Expression:
      • Expressed in a variety of tissues.

      Periostin promotes nucleus pulposus cells apoptosis by activating the Wnt/β-catenin signaling pathway WB Human,Rat 1:1000 disc specimens/NPCs

      Inhibition of Ciliogenesis Enhances the Cellular Sensitivity to Temozolomide and Ionizing Radiation in Human Glioblastoma Cells WB Human /M059K cells

      FGF18–FGFR2 signaling triggers the activation of c-Jun–YAP1 axis to promote carcinogenesis in a subgroup of gastric cancer patients and indicates translational potential. ONCOGENE 2020 Sep 15 WB Human MGC-803 cell,AGS cell

      Sabutoclax, pan-active BCL-2 protein family antagonist, overcomes drug resistance and eliminates cancer stem cells in breast cancer. CANCER LETTERS 2018 Feb 27 WB Human MCF-7 cell,CALDOX cell,MCF-7/A02 cell,Cal51 cell

      Increased hemoglobin and heme in MALDI-TOF MS analysis induce ferroptosis and promote degeneration of herniated human nucleus pulposus. MOLECULAR MEDICINE Mol Med. 2021 Dec;27(1):1-15 WB Human Human nucleus pulposus cells

      Tanshinone IIA mediates SMAD7-YAP interaction to inhibit liver cancer growth by inactivating the transforming growth factor beta signaling pathway. Aging-US Aging-Us. 2019 Nov 15; 11(21): 9719–9737 IHC Human,Mouse 1:200 liver cancer tissue,Bel-7404 cell-Xenograft

      miR-125a-5p inhibits tumorigenesis in hepatocellular carcinoma. Aging-US Aging-Us. 2019 Sep 30; 11(18): 7639–7662 WB Human Bel-7404 cell, SK-Hep1 cell

      MiR-15b is a key regulator of proliferation and apoptosis of chondrocytes from patients with condylar hyperplasia by targeting IGF1, IGF1R and BCL2. OSTEOARTHRITIS AND CARTILAGE Osteoarthr Cartilage. 2019 Feb;27:336 WB,IHC,IF Human articular cartilage,condyle cartilage

      Enhanced autophagy reveals vulnerability of P-gp mediated epirubicin resistance in triple negative breast cancer cells. APOPTOSIS Apoptosis. 2016 Apr;21(4):473-488 WB Human MDA-MB-231 cell

      A preparation of Ginkgo biloba L. leaves extract inhibits the apoptosis of hippocampal neurons in post-stroke mice via regulating the expression of Bax/Bcl-2 and Caspase-3. JOURNAL OF ETHNOPHARMACOLOGY J Ethnopharmacol. 2021 Nov;280:114481 IHC,IF,WB Mouse 1:110,1:1000 Hippocampus Hippocampal cell line HT-22

      Omega‑3 polyunsaturated fatty acids inhibit IL‑11/STAT3 signaling in hepatocytes during acetaminophen hepatotoxicity. INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE Int J Mol Med. 2021 Oct;48(4):1-10 WB Mouse 1:100 Primary hepatocytes

      Myeloid NEMO deficiency promotes tumor immunosuppression partly via MCP1-CCR2 axis. EXPERIMENTAL CELL RESEARCH Exp Cell Res. 2021 Feb;399:112467 WB Mouse Myeloid cell-Xenograft

      The induction of apoptosis and autophagy in human hepatoma SMMC-7721 cells by combined treatment with vitamin C and polysaccharides extracted from Grifola frondosa. APOPTOSIS 2017 Sep 11 WB Human SMMC-7721 cell

      Long noncoding RNA CEBPA-DT promotes cisplatin chemo-resistance through CEBPA/BCL2 mediated apoptosis in oral squamous cellular cancer. International Journal of Medical Sciences Int J Med Sci. 2021; 18(16): 3728–3737 WB Human 1:500 Cal27-CisR,HSC4-CisR

      Mesenchymal stem cell-conditioned medium improved mitochondrial function and alleviated inflammation and apoptosis in non-alcoholic fatty liver disease by regulating SIRT1. BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Biochem Bioph Res Co. 2021 Mar;546:74 WB Human,Mouse Liver L-O2 cell

      The role of insulin-like growth factor 1 in ALS cell and mouse models: A mitochondrial protector. BRAIN RESEARCH BULLETIN Brain Res Bull. 2019 Jan;144:1 WB Mouse 1:500 spinal cord

      Systemic administration of scAAV9-IGF1 extends survival in SOD1G93A ALS mice via inhibiting p38 MAPK and the JNK-mediated apoptosis pathway. BRAIN RESEARCH BULLETIN Brain Res Bull. 2018 May;139:203 WB Mouse lumbar spinal cord

      Long non-coding RNA CEBPA-AS1 correlates with poor prognosis and promotes tumorigenesis via CEBPA/Bcl2 in oral squamous cell carcinoma. CANCER BIOLOGY & THERAPY 2018 Jan 15 WB Human 1:500 Tca8113 cell,Cal27 cell

      Emodin Alleviates Intestinal Barrier Dysfunction by Inhibiting Apoptosis and Regulating the Immune Response in Severe Acute Pancreatitis. PANCREAS Pancreas. 2021 Sep;50(8):1202-1211 WB Mouse 1:500 Distal ileum

      Huaier Augmented the Chemotherapeutic Sensitivity of Oxaliplatin via Downregulation of YAP in Hepatocellular Carcinoma. Journal of Cancer J Cancer. 2018; 9(21): 3962–3970 WB Human Bel-7404 cell,SMMC-7721 cell

      Specific inhibitor of Notch‑3 enhances the sensitivity of NSCLC cells to gemcitabine. ONCOLOGY REPORTS Oncol Rep. 2018 Jul;40(1):155-164 WB Human 1:1000 H1299 cell, A549 cell

      Huaier Restrains Proliferative and Migratory Potential of Hepatocellular Carcinoma Cells Partially Through Decreased Yes-Associated Protein 1. Journal of Cancer J Cancer. 2017; 8(19): 4087–4097 WB Human Bel-7404 cell,SMMC-7721 cell

      Knockdown of IKKβ Inhibits Tumor Development in a Leptomeningeal Metastasis Mouse Model and Proliferation of Lung Cancer Cells. Cancer Management and Research Cancer Manag Res. 2020; 12: 6007–6017 WB Mouse Lewis lung carcinoma (LLC) cell

      The Effect of SPTLC2 on Promoting Neuronal Apoptosis is Alleviated by MiR-124-3p Through TLR4 Signalling Pathway. NEUROCHEMICAL RESEARCH Neurochem Res. 2019 Sep;44(9):2113-2122 WB Mouse 1:2000 cortical neurons

      scAAV9-VEGF prolongs the survival of transgenic ALS mice by promoting activation of M2 microglia and the PI3K/Akt pathway. BRAIN RESEARCH Brain Res. 2016 Oct;1648:1 WB Mouse 1:1000 spinal

      Intrathecal Delivery of ssAAV9-DAO Extends Survival in SOD1G93A ALS Mice. NEUROCHEMICAL RESEARCH Neurochem Res. 2017 Apr;42(4):986-996 WB Mouse spinal cord

      Methylation-induced silencing of miR-34a enhances chemoresistance by directly upregulating ATG4B-induced autophagy through AMPK/mTOR pathway in prostate cancer. ONCOLOGY REPORTS 2015 Oct 16 WB Human PC-3 cell, DU145 cell

      Hydroxysafflor Yellow A Attenuates Hydrogen Peroxide-Induced Oxidative Damage on Human Umbilical Vein Endothelial Cells. Evidence-based Complementary and Alternative Medicine Evid-Based Compl Alt. 2020;2020:8214128 WB Human 1:1000 HUVECs

      Synergistic antitumor effect of suberoylanilide hydroxamic acid and cisplatin in osteosarcoma cells. Oncology Letters 2018 Jul 27 WB Human 143B cell

      Synergistic Effect of Notch-3-Specific Inhibition and Paclitaxel in Non-Small Cell Lung Cancer (NSCLC) Cells Via Activation of The Intrinsic Apoptosis Pathway. MEDICAL SCIENCE MONITOR Med Sci Monitor. 2017; 23: 3760–3769 WB Human 1: 1000 A549 cell, H1299 cell

      Resveratrol ameliorates autophagic flux to promote functional recovery in rats after spinal cord injury. Oncotarget Oncotarget. 2018 Feb 2; 9(9): 8427–8440 WB Rat 1:1000 spinal cord

      Wang, Yanqin, et al. "Neuroprotective effect and mechanism of thiazolidinedione on dopaminergic neurons in vivo and in vitro in Parkinson’s disease." PPAR research 2017 (2017).

      Zhu, Lixuan, et al. "KLF-4 is a novel target of 99Tc-MDP mediating chondrocytes inflammation via NF-κB/iNOS/VCAM1 signaling." Int J Clin Exp Med 11.4 (2018): 3524-3532.

      Shan, Liang, et al. "Heme-induced ferroptosis promotes human lumbar disc degeneration analyzed by MALDI-TOF MS." (2021).

      Effects of 8-Amino-Isocorydine, a Derivative of Isocorydine, on Gastric Carcinoma Cell Proliferation and Apoptosis." Current Therapeutic Research 94 (2021): 100624.

      Rui, Tongyu, et al. "A TrkB receptor agonist N-acetyl serotonin provides cerebral protection after traumatic brain injury by mitigating apoptotic activation and autophagic dysfunction." Neurochemistry international 132 (2020): 104606.

      Mesenchymal stem cell-derived extracellular vesicles promote apoptosis in RSC96 Schwann cells through the activation of the ERK pathway. International Journal of Clinical and Experimental Pathology Int J Clin Exp Patho. 2018; 11(11): 5157–5170 WB Rat RSC96 cell

      Astragaloside IV Attenuates the Myocardial Injury Caused by Adriamycin by Inhibiting Autophagy. Frontiers in Pharmacology Front Pharmacol. 2021 May;0:1289 WB Rat 1 : 1500 Myocardial tissue

      Chlamydia psittaci inclusion membrane protein CPSIT_0842 induces macrophage apoptosis through MAPK/ERK-mediated autophagy INTERNATIONAL JOURNAL OF BIOCHEMISTRY & CELL BIOLOGY Yimou Wu WB Human human monocytic leukemia cell line THP-1 cell

      MLK4 promotes glucose metabolism in lung adenocarcinoma through CREB-mediated activation of phosphoenolpyruvate carboxykinase and is regulated by KLF5. Ka-Fai To WB Human A5749 cell,H2030 cell

      FGF12 regulates cell cycle gene expression and promotes follicular granulosa cell proliferation through ERK phosphorylation in geese. Xingyong Chen WB Geese 1:1000 granulosa cell

      Crosstalk between autophagy inhibitor and salidroside-induced apoptosis: A novel strategy for autophagy-based treatment of hepatocellular cancer. INTERNATIONAL IMMUNOPHARMACOLOGY Haixiang Su IHC,WB Mouse,Human 1:200,1:1000 HepG2 cell-xenograft HepG2 cell,97H cell

      Oncogene SCARNA12 as a potential diagnostic biomarker for colorectal cancer Molecular Biomedicine Zhang Hong WB Human 1:2000 SW620 cell,HT29 cell,HCT116 cell

      • Products Images
      • Various whole cell lysates were separated by 10% SDS-PAGE, and the membrane was blotted with anti-BCL-2(PTR2303)antibody. The HRP-conjugated Goat anti-Mouse IgG(H + L) antibody was used to detect the antibody. Lane 1: THP-1 Lane 2: MOLT-4 Lane 3: Raji Lane 4: HL-60 Lane 5: K562 Lane 6: Daudi Lane 7: Raw264.7 Lane 8: Mouse spleen Lane 9: Rat thymus
      • Various whole cell lysates were separated by 8% SDS-PAGE, and the membrane was blotted with anti-SMMHC (PT0614) antibody. The HRP-conjugated anti-Mouse IgG antibody was used to detect the antibody. Lane 1: MCF7 Lane 2: A431 Lane 3: Jurkat
      • Western blot analysis of lysates from 1)Hela cell , 2)Hela cells knockdown by siRNA1 (F:GGAUGACUGAGUACCUGAATT,R:UUCAGGUACUCAGUCAUCCTT) siRNA2(F:GUGAUGAAGUACAUCCAUUAU,R:AUAAUGGAUGUACUUCAUCAC), (Green) primary antibody was diluted at 1:1000, 4°over night, Dylight 800 secondary antibody(Immunoway:RS23910)was diluted at 1:10000, 37° 1hour. (Red) GAPDH rabbit (Immunoway:YN5585) antibody was diluted at 1:5000 as loading control, 4° over night, Dylight 680 secondary antibody(Immunoway:RS23720)was diluted at 1:10000, 37° 1hour.
      • Zhang, J., Wong, C.C., Leung, K.T. et al. FGF18–FGFR2 signaling triggers the activation of c-Jun–YAP1 axis to promote carcinogenesis in a subgroup of gastric cancer patients and indicates translational potential. Oncogene 39, 6647–6663 (2020). 
      • Wen, Yao-An, et al. "Phosphoglycerate mutase 1 knockdown inhibits prostate cancer cell growth, migration, and invasion." Asian journal of andrology 20.2 (2018): 178.
      • Tao, Yuquan, et al. "Huaier Augmented the Chemotherapeutic Sensitivity of Oxaliplatin via Downregulation of YAP in Hepatocellular Carcinoma." Journal of Cancer 9.21 (2018): 3962.
      • Hu, Bi‑Dan, et al. "Specific inhibitor of Notch‑3 enhances the sensitivity of NSCLC cells to gemcitabine." Oncology reports40.1 (2018): 155-164.
      • Yu, Xiao, et al. "The modified Yi qi decoction protects cardiac ischemia-reperfusion induced injury in rats." BMC complementary and alternative medicine 17.1 (2017): 330.
      • He, Fenglian, et al. "Synergistic effect of Notch-3-specific inhibition and paclitaxel in non-small cell lung cancer (NSCLC) cells via activation of the intrinsic apoptosis pathway." Medical science monitor: international medical journal of experimental and clinical research 23 (2017): 3760.
      • Wang, Peng, et al. "Resveratrol ameliorates autophagic flux to promote functional recovery in rats after spinal cord injury." Oncotarget 9.9 (2018): 8427.
      • Western blot analysis of lysates from 1)Hela, 2) MCF-7 cells, (Green) primary antibody was diluted at 1:1000, 4°over night, secondary antibody(Immunoway:RS23910)was diluted at 1:10000, 37° 1hour. (Red) Actin β Polyclonal Antibody (Immunoway:YT0099) antibody was diluted at 1:5000 as loading control, 4° over night,Dylight 680 secondary antibody(Immunoway:RS23720)was diluted at 1:10000, 37° 1hour.
      • The picture was kindly provided by our customer
      • Western Blot analysis of chicken cell lysis using Antibody diluted at 1:1000
      • The picture was kindly provided by our customer. Primary antibody was diluted at 1:2000. Loading control antibody was diluted at 1:5000